Overview
Current Genetic Basis of Identification
Forensic analysis relies upon the genetic inheritance of DNA in the form of a sequence of A, G, C and T nucleotides on the chromosome. The specific arrangements and number of repeats in a region of DNA is polymorphic and thus may be used to distinguish one individual from another.
4 Repeat Allele
| Individual A | …TTATAGTCAGTCAGTCAGTCTTACGT… |
|---|
6 Repeat Allele
| Individual B | …TTATAGTCAGTCAGTCAGTCAGTCAGTCTTACGT… |
|---|
4 Repeat Allele
| Evidence | …TTATAGTCAGTCAGTCAGTCTTACGT… |
|---|
In this example, Individual A differs from Individual B, yet is consistent with the profile obtained from the Evidence sample, suggesting that Individual A is a possible biological contributor of the Evidence sample. When testing is conducted across multiple genetic sites (chromosomes) by STR or SNP microarray technologies, highly probative statistical frequencies favoring a match may be obtained.